|
|
|||
|
Eleni Papadopulos-Eleopulos, Biophysicist Department of Medical Physics, Royal Perth Hospital, Western Australa, Valendar F Turner, John Papadimitriou, Barry Page, David Causer, Helman Alfonso
Send response to journal:
|
Did Montagnier prove the existence of “HIV”?
In his rapid response “Re: More On Genomic Variability” (24th October 2003), Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "In his reference 1: (i) the authors compared not only human influenza A viruses but also influenza A viruses of birds obtained at different times from around the world (A/Turkey/Ontario/6118/68, A/Duck/Alberta/60/76, A/Gull/Maryland/704/77, A/Duck/Czechoslovakia/58, A/Shearwater/Australia/1/72, A/Turkey/Wisconsin/66, A/Duck/England/56, A/Duck/Ukraine/1/63, A/Tern/South Africa/61) (This is the same as comparing "HIV-1", "HIV-2", "SIV" and other animal immunodeficiency viruses such feline); (ii) the sequence differences were based upon several assumptions. " Christopher Noble responds: “I have already provided with a number of examples of human influenza A hemagglutinins that differ by approximately 50%. I cannot understand how you can continue to deny simple facts.”
Yet when we asked for published references supporting the 50% variations, in the only reference Christopher Noble provided and as the above quote shows, “the authors compared not only human influenza A viruses but also influenza A viruses of birds obtained at different times from around the world” and “the sequence differences were based upon several assumptions”. So where are the published references “of examples of human influenza A hemagglutinins that differ by approximately 50%”? Is it sufficient to report genomic variability from databases or should not we also ask what are the biological consequences of these variabilities? The question also arises are all these variabilities real or are at least some of them the result of errors in PCR and phylogenetic tree analysis?
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "Since the topic of this debate is still "HIV", it is not sufficient to just look at databases and phylogenetic trees and the existence/non- existence of a given virus cannot be either proven or disproven by another virus, our answer remains the same." Christopher Noble responds: “It may not be sufficient to look at databases of genetic sequences and phylogenetic trees of these sequences to discuss the existence of a virus. However, it is absolutely essential to look at this evidence - ALL of the evidence including genome sequences. The fact that you continue to ignore this evidence only demonstrates why you are often referred to as a "Denialist". You deny the evidence. The ironic thing is that you have specifically referred to the genetic sequences of influenza A and poliovirus in an attempt to disprove the existence of HIV. Now you are doing your best to avoid the issue. You brought up the issue of the genome of influenza A and poliovirus not me.”
If as Christopher Noble admits “It may not be sufficient to look at databases of genetic sequences and phylogenetic trees of these sequences to discuss the existence of a virus” then, since the topic of this debate is the existence of the “HIV” virus, why is it “absolutely essential to look at this evidence”? Would Christopher Noble please tell us what evidence “databases of genetic sequences and phylogenetic trees” give us regarding the existence of a virus? We have always thought that to prove the existence of the “HIV” virus, you have to isolate/purify it and then proceed to define its genome and genomic sequences and its proteins. Otherwise, how do you know that the genomic sequences are those of “HIV” and the proteins are coded by these sequences? It is obvious that you cannot start with impure material to define the origin of the genome. If Christopher Noble has another way would he please tell us what it is?
At the risk of becoming monotonous let us state again that we introduced genomic variability only in regard to the issues of defining “HIV” infection in molecular terms and by antibody testing, protein function and design of vaccines. Christopher Noble has never addressed the issues of vaccine design and the defining of “HIV” infection in molecular terms.
In his rapid response “Divergent HIV strains and antibody tests” (14 October 2003), Christopher Noble listed several “antibody tests that include HIV-1 group O specific antigens”.
In our rapid response “Re: Divergent HIV strains and antibody tests” (16 October 2003), we asked Christopher Noble: “Would he please tell us: (i) in which countries these tests are routinely used? (ii) Are they used as screening tests or as confirmatory tests?” Since Christopher Noble did not answer us we have analysed the references he provided. It appears that not one of these tests is a confirmatory test — they are all ELISA tests and none are used in clinical practice.
As far as the effect of protein variability on their function is concerned, let us quote from a recent article published in Nature: “Small genetic variations between people — or polymorphisms — can alter the behaviour of proteins that carry a drug to its target cells or tissues, cripple the enzymes that activate a drug or aid its removal from the body, or alter the structure of the receptor to which a drug is supposed to bind. Variation in immune-system genes can also influence how particular drugs are tolerated. Together, these subtle genetic variations mean that the dose at which a drug will work may vary hugely from person to person. And with today's 'one-size-fits-all' prescribing, that can lead to life-threatening adverse reactions or to a drug completely failing to do its job. Yet the genomics revolution has given us the tools to identify people who don't fit the standard prescribing mould. Single nucleotide polymorphisms, or SNPs, are single-letter changes in the genetic code that are scattered throughout the genome. They can now be profiled with increasing efficiency, and used to highlight polymorphic genes that influence our response to individual drugs.” (1)
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "Let us again reiterate that the 1% variability is not our claim but that of a number of virologists." No, it is not the view of a number of virologists. You are either deliberately or through ignorance conflating several completely different aspects of RNA virus genomes. In the case of HIV you talk about the genetic difference between highly divergent strains. These strains have diverged over time just as strains of influenza A and poliovirus diverge over time. In other cases you refer to the variation in a quasispecies in an individual at a given time. These are fundamentally different things. The fact that you continue to talk about these two things interchangeably suggests to me that either you do not understand what you read in these papers or that you are deliberately attempting to mislead readers.”
At the risk of even more monotony let us state again that the 1% variability of the genome of RNA viruses is not ours as is obvious from the reference we have provided and from which we have repeatedly and extensively quoted in our previous rapid responses.
Would Christopher Noble please tell us: (i) Where is the proof that “HIV” strains have diverged over time? (ii) What proof does he have that we are either deliberately or ignorantly conflating divergence over time with Eigen’s quasispecies? (iii) Where have we been deliberately attempting to mislead readers?
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "Regarding how loose the leash can be, we felt that Christopher Noble would consider more readily the views of eminent virologists such as Robert Gallo, Peter Duesberg, Esteban Domingo and researchers from the Pasteur Institute rather than ours. That is why we gave their views in our rapid response "Genomic Variability" (14th October 2003). If Christopher Noble disagrees with their views, perhaps he may try to convince them to change their views and rewrite virology. " Christopher Noble responds: “I do not disagree with the views of these researchers. I disagree with your misrepresentation of their views. They do not agree with you. These researchers have never, ever said "the genomes of RNA viruses do not differ by more than 1%". You are the one that has made this claim.”
We are glad that Christopher Noble agrees with the views of the researchers whose published papers we gave in our rapid response “Genomic Variability” (14 October 2003). We agree that in those papers, the researchers never said that the genomes of RNA viruses do not differ by more than 1%. However, neither did they say that the genomes of RNA viruses may differ by 50% without any consequences including their survival. Indeed, their whole argument was that the leash cannot be too loose.
Let us again present the views of those researchers.
As we wrote in our rapid response “Finding wood among the trees” (22 September 2003): “According to Esteban Domingo, one of the first researchers to search for variability in the genome of RNA viruses and to apply Eigen’s quasispecies concept to the genome of RNA viruses: “RNA viruses replicate near the error threshold for maintenance of genetic information, and an increase in mutation frequency during replication may drive RNA viruses to extinction in a process termed lethal mutagenesis.” Or “virus entry into error catastrophe” and because of this, he advocates the use of mutagenic agents as anti-viral. (2,3)
Since Christopher Noble agrees with this view but says that we have misrepresented it would Christopher Noble tell us what number he regards as being the maximum allowable “error threshold” for RNA viruses? Is it as much as 5% or 80% or a percentage in between?
In 1985 Gallo wrote: “Sequences from different clones of HTLV-III allow an analysis of the level of sequence diversity of the virus. A comparison of clones BH8 and BH5 with BH10 demonstrates a 0.9% base pair polymorphism in the coding regions of the genome…The resultant differences in viral protein function remain to be determined…Diversity among different HTLV-III isolates seems to be greater than that between different HTLV-I isolates…These differences could be important factors in the design of agents useful for viral detection or for therapeutic agents.”(4)
As far back as 1989 – 1992 when the “extraordinary variability” of the “HIV” genome was not known, researchers from the Pasteur Institute including Wain-Hobson were of the opinion that: “The task of defining HIV infection in molecular terms will be difficult” (5,6)
According to Peter Duesberg: "there is a range, a small range, in which you can mutate around without too much penalty, but as soon as you exceed it you are gone, and you are not HIV any longer, or a human any longer...then you are either dead or you are a monkey, or what have you". (7)
Would Christopher Noble please tell us whether the views of these researchers are closer to our view or to Christopher Noble’s view of genomic variability?
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "In the same paper, one reads: "amino acid sequence homology within a serotype is 80% or more even between virus strains readily distinguishable by polyclonal?substitution of a single amino acid out of five to six residues which usually make up an antigenic determinant may profoundly alter the antigenicity? (1). So protein variability does lead to functional and antigenic variations. That this is the case, one need look no further than the sickle cell syndromes".
Christopher Noble responds: “Huh? Where was functional variation mentioned? You don't appear to understand the citation you have given. You do mention an important aspect. The antigenicity of a protein is determined by only a few, five or six, amino acids. This is a small proportion of the amino acids in a protein such as HIV gp41. Substitutions in the rest of the protein that do not affect this epitope will not affect the antigenicity. Hence conserved epitopes are important for both antibodies tests and possible vaccines.”
Yes, in the part which Christopher Noble quotes us, there is no indication of functional variation. But here Christopher Noble has changed our quote so that it does make much sense by putting a “?” in place of “…” that we had put in the middle to show a break in the text of the paper we quoted from and also at the end to show that the sentence continues. Not only has he changed what we quoted but amazingly he omitted the part of our rapid response which precedes the part he quotes which reads: “In this paper the authors wrote: “The hemagglutinin (HA) glycoprotein of influenza A virus performs two crucial functions in the early stage of virus infection. First, HA is responsible for binding of the virus to cell surface receptors and second, it mediates liberation of the viral genome into the cytoplasm through membrane fusion…Receptor-binding specificity was assayed with gangliosides containing sugar chains with either N-acetylneuraminic acid (NeuAc) or N-glycolylneuraminic acid (NeuGc) and with either NeuAcα2,3Gal or NeuAcα2,6Gal linkage for the HA of human and avian origin, and of various serotypes (H1 through H10 with the exception of H7)…It is worth noting that A/PR/8/34 (H1N1), A/Duck/Ukraine/1/63 (H3N8), A/Duck/Czechoslovakia/56 (H4N6), A/Tern/South Africa/61 (H5N3), A/Turkey/Ontario/6118/68(H8N4), and A/Chicken/Germany “N”/49 (H10N7) preferentially bound to NeuAcα2,3Gal-containing oligosaccharides, whereas, A/Japan/305/57 (H2N2), A/Aichi/2/68 (H3N2), A/Shearwater/Australia/1/72(H6N5), and A/Turkey/Wisconsin/66(H9N2) bound to NeuAcα2,6Gal-containing oligosaccharides.”
Here the authors refer the binding as being one of the two crucial functions and then proceed to show that genomic variability leads to binding variability. So why does Christopher Noble make such statements?
Our conclusion “So protein variability does lead to functional and antigenic variations” refers to our complete quote and not just to the Christopher Noble extraction. So would Christopher Noble tell us what we don’t understand?
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "Christopher Noble may be able to convince these virologists that amino acid polymers having variations of 60%, 81% or even 100% represent the same protein which perform the same function, can be detected by the same antibody test, can be considered to be the same constituent of a viral particle which can be neutralized by vaccines to this protein. He may also be able to convince them that if there is a 60% change in their proteins, they will still be Peter Duesberg, Robert Gallo, Esteban Domingo, Wain-Hobson, they will still look the same and perform the same functions. Then he may be able to rewrite not only virology and molecular biology but also biology."
Christopher Noble responds: “I have never said amino acid polymers having variations of 60%, 81% or even 100% can be detected by the same antibody test. Please retract this at once. This is not the first time you have misrepresented my statements. This claim is purely your invention. I have been consistently arguing that divergent strains of HIV cannot be detected with antibody tests that use only one set of antigens. To detect divergent strains of HIV like HIV-1 group O you need to include HIV-1 group O antigens in the antibody test.”
We are glad that Christopher Noble agrees that to detect divergent strains of “HIV” you need different antibody tests. Would Christopher Noble please tell us what are the different Western Blots used routinely in clinical practice in the last 20 years around the world to confirm infection with different “HIV” strains?
Would Christopher Noble please answer our other questions which we have asked him, that is, “that amino acid polymers having variations of 60%, 81% or even 100% represent the same protein which perform the same function,…can be considered to be the same constituent of a viral particle which can be neutralized by vaccines to this protein”.
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: "We don't know how Christopher Noble found only around 18 base pairs similarities between human endogenous sequences and "HIV" sequences. A few examples will illustrate that this is not the case”. He responds "I have frequently heard the claim that HIV could be endogenous. The usual papers given are from Howard Urnovitz who you have also cited. He claims HIV sequences can be found in the human genome. (1). The evidence he gives is a few sequences of about 18 bps that have a similarity of 89% or greater with human sequences from the Homo Sapiens database at www.ncbi.nlm.nih.gov. As I stated previously similar matches between human sequences and other viruses exist so there is as much evidence that other viruses are endogenous as there is for HIV. Horwitz et al describe a couple of human sequences that show again small sequences of bps that have a similarity of around 90% to HIV sequences. (2) The sequences are available online for everybody. (3) If you align them with HIV sequences using BLAST at http://www.hiv.lanl.gov/ you find that there are matches of around 32 bps between EHS-2 and HIV sequences. AF217180|HIV-1|546MONO46|B|US|-|HIV-1 isolate 546mono-46 from USA, env gene, complete cds. Length = 2641 Score = 42.8 bits (26), Expect = 0.016 Identities = 29/32 (90%) Strand = Plus / Plus Query: 1331 cagaaatgggtggagagagagacagagacaga 1362 Sbjct: 2249 cagaagaaggtggagagagagacagagacaga 2280 Similar matches can also be found between the same EHS-2 sequence and other viruses such as herpes simplex virus. >gi|6572414|emb|Z86099.2|HSV2HG52 Herpes simplex virus type 2 (strain HG52), complete genome Length = 154746 Score = 32.2 bits (16), Expect = 88 Identities = 28/32 (87%) Strand = Plus / Minus Query: 1333 gaaatgggtggagagagagacagagacagaga 1364 Sbjct: 120065 gaaatgtgaggagagcgagacagagagagaga 120034 The matches are interesting but nobody is claiming (except for Stefan Lanka) that herpes simplex does not exist. None of the other references that you have given gave any evidence that extensive sequence similarities exist between the HIV and human genomes. If you have some evidence to support your claims please provide them. Some sequences and alignments would be sufficient.”
Before one can start considering whether “HIV” is either an exogenous or a endogenous retrovirus, one must first have proof of the existence of “HIV”. We have never cited Howard Urnovitz in relation to the nature of “HIV”. If in the references we have referred to there is no evidence that “sequence similarities exist between the HIV and human genomes” would Christopher Noble please explain the positive hybridization results in non-AIDS patients with the “HIV” probes?
Would Christopher Noble also please explain the 0% - 100% specificity of the PCR test?
Christopher Noble wrote: “Eleni Papadopulos-Eleopulos writes: " As far as experiments are concerned the Perth Group has repeatedly proposed the need for experiments as well as actual experiments. Regrettably both lack of money and obstruction by our protagonist colleagues and others have so far prevented these from taking place." He responds: “It seems that the "HIV Dissidents" do have money at least $100,000 (4). However it is much easier to sit back and demand that everybody must "prove" that HIV exists, especially when you set yourself up as the sole judge of what that "proof" is. It is far more difficult to buy a few reagents and cell lines and produce evidence for your claims.”
Alexander Russell wrote: “I am offering $100,000 Reward for the first person who can prove that ‘HIV’ exists via visual confirmation.”(8) That is, this money is offered to the person who has already proven the existence of “HIV” as a reward. It is not offered to perform the experiments to either prove or disprove the existence of “HIV” as a grant but only as a prize to whoever first already performed the experiments and produced the necessary proof.
We agree with Christopher Noble that “It is far more difficult to buy a few reagents and cell lines and produce evidence for your claims.”
Christopher Noble wrote: “This is not the way that science works. There is no such thing as absolute 'proof' in science. Rather there is evidence and in the case of HIV enough evidence to convince 99.9999% of scientists that HIV exists and causes AIDS.”
Does Christopher Noble mean 99.9999% of all scientists or 99.9999% of all AIDS scientists? If the former then since the vast majority of the world’s scientists are not AIDS scientists, 99.9999% of them accept the “HIV” theory of AIDS because of the pronouncements of others. Would Christopher Noble please explain why 99.9999% of scientists cannot be wrong? It would be neither the first nor the last time that 99.9999% of scientists have been wrong.
Christopher Noble wrote: “Science does not proceed by a few individuals saying: "Electrons are just a metaphor for a lot of quasi-related phenomena. No one has ever proved its existence as a particle. We don't believe they exist. Such people are ignored. Likewise, I predict that you will be ignored.”
Viruses are not electrons. They are particles which can be seen using electron microscopes, can be obtained separate from everything else and their constituents determined precisely. The theory of electrons as negatively charged particles is a theory whose predictions have been tested and verified. Would Christopher Noble tell us what predictions of the “HIV” theory have been tested and verified?
Since Christopher Noble has avoided answering all our basic questions regarding the existence of “HIV” let us start from the beginning. Would Christopher Noble tell us whether in his view Montagnier proved the existence of a retrovirus “HIV” in 1983? (8) If Christopher Noble avoids answering this question it will mean that in his view no such proof can be found in the 1983 paper by Montagnier and his associates.
References(1) (2003) Nature 425:760-762. (2) Pariente N, Airaksinen A, Domingo E. (2003) Mutagenesis versus inhibition in the efficiency of extinction of foot-and-mouth disease virus. Journal of Virology 77(12): 7131-7138. (3) Domingo E. (2003) Quasispecies and the development of new antiviral strategies. Progress in Drug Research 60: 133-158. (4) Ratner L, Haseltine W, Patarca R, Livak KJ, Starcich B, Josephs SF, Doran ER, Rafalski JA, Whitehorn EA, Baumeister K, Gallo RC, Wong-Staal F. (1985) Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 313: 277-284. (5) Vartanian JP, Meyerhans A, Henry M, Wain-Hobson S. (1992) High-resolution structure of an HIV-1 quasispecies: identification of novel coding sequences. AIDS 6(10): 1095-1098. (6) Meyerhans A, Cheynier R, Albert J, Seth M, Kwok S, Sninsky J, et al. (1989) Temporal fluctuations in HIV quasispecies in vivo are not reflected by sequential HIV isolations. Cell 58(5): 901-910. (7) Conlan M. Interview with Peter Duesberg. Reappraising AIDS 1998 (February/March). www.virusmyth.net/aids/data/mcinterviewpd.htm (8) Barré-Sinoussi, F. et al. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220, 868-71 (1983).
Competing interests: None declared |
|||
|
| ||||